addressalign-toparrow-leftarrow-rightbackbellblockcalendarcameraccwchatcheckchevron-downchevron-leftchevron-rightchevron-small-downchevron-small-leftchevron-small-rightchevron-small-upchevron-upcircle-with-checkcircle-with-crosscircle-with-pluscrossdots-three-verticaleditemptyheartexporteye-with-lineeyefacebookfolderfullheartglobegmailgoogleimageimagesinstagramlinklocation-pinmagnifying-glassmailminusmoremuplabelShape 3 + Rectangle 1outlookpersonplusprice-ribbonImported LayersImported LayersImported Layersshieldstartickettrashtriangle-downtriangle-uptwitteruseryahoo

IL-2 sequence from last week's meetup

From: Eri G.
Sent on: Tuesday, January 26, 2010 10:54 PM
Text version. I have the actual Gene Designer file (you'll need the program to open it) but I can't send through meetup.com; so, if you want the file, email me and I'll send it

Gene:

GAATTCATGGCTCCTACTTCTTCTTCTACTAAGAAAACTCAACTGCAACTGGAACACCTGCTGCTGGACCTGCAGATGATTCTGAATGGTATTAACAACTACAAAAACCCGAAACTGACCCGTATGCTGACCTTCAAATTCTATATGCCGAAGAAGGCTACTGAACTGAAGCACCTGCAGTGCCTGGAAGAGGAGCTGAAACCGCTGGAGGAAGTCCTGAACCTGGCTCAGTCCAAAAATTTCCATCTGCGTCCGCGCGATCTGATCTCCAACATCAATGTTATCGTACTGGAACTGAAAGGCTCTGAGACCATTTTCATGTGTGAATACGCGGACGAAACGGCTACGATTGTCGAATTTCTGAACCGTTGGATTACCTTCTGTCAGTCCATCATTAGCACCCTGACTGAGAACCTGTACTTCCAGGGTCACCACCATCACCACCACTAAGGATCC

Protein:

MAPTSSSTKKTQLQLEHLLLDLQMILNGINNYKNPKLTRMLTFKFYMPKKATELKHLQCLEEELKPLEEVLNLAQSKNFHLRPRDLISNINVIVLELKGSETIFMCEYADETATIVEFLNRWITFCQSIISTLTENLYFQGHHHHHH

Our Sponsors

People in this
Meetup are also in:

Sign up

Meetup members, Log in

By clicking "Sign up" or "Sign up using Facebook", you confirm that you accept our Terms of Service & Privacy Policy