Mailing List Archive

Subject Sender Date
Happy Holidays! + Looking for a sponsors - Hi everyone, The next event will be a special DIYbio night with Jason Bobe , Director of Community for The Personal Genome Project and Cofounder of diybio.org. (Tentative date/tim Eri G. Nov 30, 2010 5:39 PM
GE: ecomagination Innovation Challenge Winners Announced! - Eri G. Nov 19, 2010 2:25 PM
RE: [biocurious] BioCurious Packing Party this Thu, Nov 18th, 7pm - Consumables......food, or packing supplies, staples, chocolate? --- On Tue, 11/16/10, Adam Perrotta <[address removed]> wrote: Gerald W. Nov 18, 2010 1:33 PM
RE: [biocurious] BioCurious Packing Party this Thu, Nov 18th, 7pm - Mailing packages? I would need more details. What about Adam P. Nov 16, 2010 3:32 PM
Re: [biocurious] BioCurious Packing Party this Thu, Nov 18th, 7pm - Hi Biocurious, Could I be directed to the location where I can find more detail about this event? Cheers, Ben H. On Tue, Nov 16, 2010 at 11:18 AM, Eri Gentry < Ben H. Nov 16, 2010 11:43 AM
Re: [biocurious] BioCurious Packing Party this Thu, Nov 18th, 7pm - @Gerald, I'll be getting food and drink for people. I'm sure we could always use more of these consumables. Another thing @everyone would be swag we could include in our prize packages. T Eri G. Nov 16, 2010 11:18 AM
RE: [biocurious] BioCurious Packing Party this Thu, Nov 18th, 7pm - Dang! I would LOVE to attend but I need to work in the evenings. It seem Adam P. Nov 15, 2010 11:00 PM
Re: [biocurious] BioCurious Packing Party this Thu, Nov 18th, 7pm - Is there anything I could bring to help? --- On Mon, 11/15/10, Eri Gentry <[address removed]> wrote: Gerald W. Nov 15, 2010 9:36 PM
BioCurious Packing Party this Thu, Nov 18th, 7pm - BioCurious Packing Party Join your bio pals in Mountain View this Thursday night for drinks and food... all yours for only a couple hours of help stuffing an Eri G. Nov 15, 2010 9:12 PM
I would like to hear people's feedback on my project and story - Phil Nov 3, 2010 8:25 PM
New Meetup: Get excited and make things with science! Pre-Science Hack Day meetup! - Announcing a new Meetup for BioCurious! What : Get excited and make things with science! Pre-Science Hack Day meetup! When : Saturday, October 23,[masked]:0 Eri G. Oct 13, 2010 6:10 PM
BioCurious Celebration. Need a BIG Party Venue in SF! - In case you haven't heard the latest, BioCurious successfully raised over $35k on Kickstarter . We typically practice tight budgeting as a bootstrapped operation, but we have to Eri G. Sep 30, 2010 12:37 AM
Eri Gentry added a post - Wow! Thanks to the San Jose Mercury News article at http://bit.ly/ar4bdJ membership is up 10%. Hi new BioCurious members! Some of you sound like great future speakers. Send me a note if you've got an inte Eri G. Sep 25, 2010 12:24 AM
Meetup details changed: Synthetic Biology Documentary: An Early look at an Evolving Film - Sam has provided some new details. Here they are: I've updated this Meetup. For more details, see the full listing: http://www.meetup.com/BioCurio­us/calendar/14838271/ Eri G. Sep 23, 2010 11:45 AM
New Meetup: Synthetic Biology Documentary Film with Sam Gaty - Announcing a new Meetup for BioCurious! What : Synthetic Biology Documentary Film with Sam Gaty When : Sunday, September 26,[masked]:00 PM Whe Eri G. Sep 20, 2010 4:22 PM
Coffee, Cathal, and Citizen Science : Project Update #9: BioCurious: A Hackerspace for Biotech. - Coffee, Cathal, and Citizen Science By Joseph J, Eri G, and Tito J With 9 days left in our project, we are introducing two ne Eri G. Sep 14, 2010 5:41 PM
Meetup details changed: Cognitive Mapping with Jim Keravala - Dear BioCurious, There's been a change to Monday's meetup. Due to circumstances outside of his control, Srihari Yamanoor will not be able to make it. Filling in for him is the brilliant Jim Keravla, who recently wowed the Quantified Self crowd Eri G. Sep 11, 2010 9:25 PM
BioCurious Featured as Project of the Day on Kickstarter! - Preview not available Eri G. Sep 8, 2010 1:39 PM
September 8 • 7 pm • How to Make a Telescope - How-To Night at Bazaar Cafe 5927 California Street @ 21st Ave. September 8 ? 7 pm ? How to Make a Telescope Local amateur astronomer Douglas Smith will explain basic optics, discuss the different types of telescopes an Eri G. Sep 6, 2010 6:17 PM
New Meetup: The Rules of Brainstorming with Srihari Yamanoor - Announcing a new Meetup for BioCurious! What : The Rules of Brainstorming with Srihari Yamanoor When : Monday, September 13,[masked]:00 PM Whe Eri G. Aug 28, 2010 8:17 PM
Win Tickets!! See inside for how to enter. For love of the crush: The art and science of wine from...an Engineer! - Want to sample locally made wines? And learn the geeky details about how it's made? Me too! But if money's an issue for you, send an email to [address removed] with "Wine" in the subject line. I will select 4 people to get a f Eri G. Aug 17, 2010 8:25 PM
August Newsletter from BioCurious' Sponsor GE: ecomagination - - Eri Gentry (415)[masked] skype: sunneco biocurious.org Eri G. Aug 17, 2010 2:59 PM
New Meetup: For love of the crush: The art and science of wine from a born-again Winemaker - Announcing a new Meetup for BioCurious! What : For love of the crush: The art and science of wine from a born-again Winemaker When : Saturday, August 21, 2 Eri G. Aug 4, 2010 3:10 PM
New Meetup: BioCurious at The Tech - Announcing a new Meetup for BioCurious! What : BioCurious at The Tech When : Saturday, August 7,[masked]:00 AM Where : The Tech Museum of Eri G. Jul 29, 2010 9:05 PM
New Meetup: Hike @ Rancho San Antonio Open Space Preserve - Announcing a new Meetup for BioCurious! What : Hike @ Rancho San Antonio Open Space Preserve When : Tuesday, July 27,[masked]:00 PM Where : Eri G. Jul 18, 2010 11:29 PM
Call for Top Innovators - user 1. Jul 15, 2010 12:04 PM
Venue change: The material aesthetics of biotechnology by Philip Ross - Dear Members of BioCurious: The CABAL (GNU/Linux enthusiasts) meetup group has kindly offered their space for our meetup on Saturday. The address is 1105 Alschul Ave (near Alameda de las Pulgas) in Menlo Park. Directions are available on Eri G. Jul 8, 2010 12:15 PM
Venue needed - Hi members of BioCurious: There has been a last-minute problem with our current venue and I am looking for another to house up to 30 people on Saturday, July 10th, at 2PM. If anyone has a place they can offer or have direct links to another pl Eri G. Jul 7, 2010 12:53 AM
Re: [DIYbio] Fwd: Techshop - Hi Mac, I am a member and would love to assist you with that. ?I am also happy to give you transportation to and from. ?What time would you like to meet? -Tim On Sun, Jul 4, 201 Tim H. Jul 4, 2010 2:32 PM
Fwd: Techshop - Howdy biocurious, I'm coming to the bay area on Monday for a singularity university workshop on Tuesday. ?On Monday afternoon I want to go to techshop and manufacture the chassis of a microscope I'm de Eri G. Jul 4, 2010 2:14 PM
New Meetup: The material aesthetics of biotechnology by Philip Ross - Announcing a new Meetup for BioCurious! What: The material aesthetics of biotechnology by Philip Ross When: Saturday, July 10,[masked]:00 PM Where: supersalad's lab Grant & El Camino Real Mountain View, Eri G. Jun 18, 2010 10:13 AM
Meetup details changed: The Business of Drug and Device Development – regulation and approval essentials - The meetup date has changed to Thursday, June 24th. For more details, see the full listing: http://www.meetup.com/BioCurio­us/calendar/13781670/ When: Thursday, June 24, 201 Eri G. Jun 14, 2010 10:47 AM
New Meetup: The Business of Drug and Device Development – regulation and approval essentials - Announcing a new Meetup for BioCurious! What: The Business of Drug and Device Development ? regulation and approval essentials When: Tuesday, June 22,[masked]:00 PM Suggested donation: $10.00 per person Where: Eri G. Jun 12, 2010 2:19 PM
Meetup details changed: Miracle Fruit Party and Sour Feast - I've updated this Meetup. For more details, see the full listing: http://www.meetup.com/BioCurio­us/calendar/13689168/ When: Saturday, June 19,[masked]:00 PM Where: Eri G. Jun 3, 2010 2:37 PM
New Meetup: Miracle Fruit Party and Sour Feast - Announcing a new Meetup for BioCurious! What: Miracle Fruit Party and Sour Feast When: Saturday, June 19,[masked]:00 PM Price: $10.00 per person Where: supersalad's lab Grant & El Camino Real Eri G. Jun 3, 2010 2:24 PM
BioCurious @ Maker Faire May 22 - 23. A Call for Volunteers. - Maker Faire is coming up soon and BioCurious will have two tables at the event. Several of us are also going to speak during sessions. We're now looking for volunteers to help with simple experiments and who can photograph visitors to our booths. To off Eri G. May 5, 2010 2:59 PM
New Meetup: Chris Anderson presents Clotho, the bioCAD platform for synthetic biology - Announcing a new Meetup for BioCurious! What: Chris Anderson presents Clotho, a bioCAD platform for synthetic biology When: Saturday, May 29,[masked]:00 PM Where: Hacker Dojo 140 A S Whisman Road Mountain Vi Eri G. May 5, 2010 12:17 PM
Re: [DIYbio] Re: Ordering supplies for home lab - For everyone who wants to learn about what equipment you need for a lab, and where to get gel boxes, PCR machines, and kits at a great price, chec user 1. Apr 30, 2010 11:21 PM
Re: [DIYbio] Re: Ordering supplies for home lab - Can you get me an incubator/shaker? :). Or point me in the right direction? Glen On Apr 29, 2010, at 9:32 PM, John Schloendorn < [address removed] > Glen J. Apr 29, 2010 11:45 PM
Re: Ordering supplies for home lab - Heh Glen, my autoclave was cheaper than your pressure cooker. ?$0 actually in this case. ?Don't shy away from gear just because it& John S. Apr 29, 2010 8:30 PM
Re: Ordering supplies for home lab - Correction on the 4-Way-Tube-Rack: http://www.lightlabsusa.com/4-­Way-Tube-Rack.html On Wed, Apr 28, 2010 at 7:14 PM, Glen Jarvis Glen J. Apr 28, 2010 7:15 PM
Ordering supplies for home lab - NOTE: Forgive the long email, I do eventually get to the point: making a combined order for some more supplies. Before I ever went to the "Interleukin expression in E. coli Part I" lab, I had the mental impression t Glen J. Apr 28, 2010 7:14 PM
New Meetup: Art from the Biocurious - Announcing a new Meetup for DIYbio! What: Art from the Biocurious When: Saturday, April 24,[masked]:00 PM Where: Hacker Dojo 140 A S Whisman Road Mountain View, CA 94041 Art from the Biocurious Eri G. Apr 12, 2010 2:48 PM
I can't findi the lab - I'm sorry to spam everyone. I've been walking around the corner of El Camino Real and Grant for about 15 minutes now. I can't find the lab. I'm holding a big subway tray, have a green jacket, a brown paper bag and a blue Glen J. Apr 10, 2010 1:16 PM
New Meetup: (Lab) Interleukin expression in E. coli Part I - Announcing a new Meetup for DIYbio! What: (Lab) Interleukin expression in E. coli Part I When: Saturday, April 10,[masked]:00 PM Where: supersalad's lab Grant & El Camino Real Mountain View, CA 9404 Eri G. Mar 29, 2010 10:57 PM
Viva la algae! Join the Algae Revolution Workshop Sat April 17th in Palo Alto - Hi DIYbio-ers, For those of you who caught Aaron Wolf Baum's awesome DIYbio/algae talk - and especially for those of you who didn't - check out Aaron's workshop on the 17th, where you'll learn how to grow eatable algae. I'll see you there! Eri G. Mar 29, 2010 8:14 PM
New Meetup: Backyard Brains: Neuroscience for Everyone! - Announcing a new Meetup for DIYbio! What: Backyard Brains: Neuroscience for Everyone! When: Sunday, March 7,[masked]:00 PM Where: Eri's house Grant & El Camino Real Mountain View, CA 94041 Eri G. Feb 18, 2010 1:35 PM
IL-2 sequence from last week's meetup - Text version. I have the actual Gene Designer file (you'll need the program to open it) but I can't send through meetup.com; so, if you want the file, email me and I'll send it Gene: GAATTCATGGCTCCTACTTCTTCTTCTACT­AAGAAAACTCAACTGCAACT Eri G. Jan 26, 2010 10:54 PM
Demos at next meetup - If anyone is interesting in demo-ing their inventions at the next meetup (Feb 6th), send me a note. We can slot you in before the main presentation. Cheers, Eri Eri G. Jan 26, 2010 2:03 PM
New Meetup: DIY for/in developing countries: What can be done, how it can help, current exam - Announcing a new Meetup for DIYbio! What: DIY for/in developing countries: What can be done, how it can help, current exam When: Saturday, February 6,[masked]:30 AM Where: Eri's house Grant & El Camino R Eri G. Jan 26, 2010 1:14 PM
Re: [DIYbio] Date change for January meetup - Hi. Jan 23rd would be a lot better for me but I can make an evening weekday (would a Thursday or Fr Lucymarie Jan 3, 2010 10:39 PM
Re: [DIYbio] Date change for January meetup - Sorry! Saturday the 16th .? You're tripping me up, Joseph Jackson. - Eri (917)[masked] skype: sunneco Eri G. Jan 3, 2010 10:04 PM
Re: [DIYbio] Date change for January meetup - The meetup is currently set for Saturday the 15th at 11am Nearly any other days except the next two weekends are fine with me as alternatives - Eri (917)[masked] skype: sunneco Fight cancer livly.o Eri G. Jan 3, 2010 10:02 PM
Re: [DIYbio] Date change for January meetup - Eri I think it is ok actually. ?You have it for Friday the 15th? ?The Foresight is Sat and Sun 16-17. ?Just check it again real quick. ? On Sun, Jan 3, 2010 at 9:42 PM, supersalad < Joseph P J. Jan 3, 2010 9:44 PM
Date change for January meetup - Hi everyone, turns out our January meetup conflicts with the Foresight 2010 conference . We need to change the date. Does anyone have objections to weekday meetings (in other words, do you have Eri G. Jan 3, 2010 9:42 PM

Our Sponsors

  • Instructables

    Step-by-step directions on how to build a robot best friend (and more)

Sign up

Meetup members, Log in

By clicking "Sign up" or "Sign up using Facebook", you confirm that you accept our Terms of Service & Privacy Policy